Gene name |
SPCC1450.02 |
Gene ID |
35/H03 |
Gene synonyms/obsolete |
SPCC191.13 |
Gene product |
bromodomain protein;
involved in transcriptional regulation; RNA polymerase II
accessory protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1737 |
ORF length (spliced) |
|
Entry clone length |
1737 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
44A:G / 264T:C /
922T:C / 939T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1450.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAGCGAATCGCGTGA |
Rev primer name |
SPCC1450.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAGATTCACTACTTTCA |
Amino acid length |
578 |
Molecular weight |
65.1 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
247 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |