Gene name |
SPAC4D7.09 |
Gene ID |
35/H04 |
Gene synonyms/obsolete |
tif223 |
Gene product |
translation initiation
factor (eif-2b gamma subunit); nucleotidyltransferase |
Entry clone |
Cloned#/ 2xFS |
ORF length (unspliced) |
1739 |
ORF length (spliced) |
1407 |
Entry clone length |
1739 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
716C:deletion /
727T:addition |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4D7.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTTGTATGAGCATGC |
Rev primer name |
SPAC4D7.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTCCATGTCCGTCTCAATT |
Amino acid length |
468 |
Molecular weight |
51.6 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |