Gene name |
SPCC16C4.07 |
Gene ID |
35/C03 |
Gene synonyms/obsolete |
scw1 |
Gene product |
RNA-binding protein;
involved in septation and regulation of septum formation;
regulates cell wall structure; rrm RNA recognition motif |
Entry clone |
Cloned |
ORF length (unspliced) |
1686 |
ORF length (spliced) |
|
Entry clone length |
1686 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
208G:A / 531C:T /
786G:C / 1062A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC16C4.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGTGGGATCACCGAG |
Rev primer name |
SPCC16C4.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTGCCATACATTAGATTA |
Amino acid length |
561 |
Molecular weight |
60.3 |
Isoelectric point (calc.) |
7.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |