Gene name |
SPAC22A12.09c |
Gene ID |
35/C02 |
Gene synonyms/obsolete |
sap114 |
Gene product |
involved in mRNA
splicing; Surp domains; complexed with Cdc5p |
Entry clone |
Cloned |
ORF length (unspliced) |
1686 |
ORF length (spliced) |
1446 |
Entry clone length |
1686 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
184T:C / 293T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC22A12.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTCTTTAATGGAATT |
Rev primer name |
SPAC22A12.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCGGCGTTTATTTGTGGGA |
Amino acid length |
481 |
Molecular weight |
54.4 |
Isoelectric point (calc.) |
8.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPSISSLDL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |