| Gene name |
SPAC24B11.07c |
| Gene ID |
35/C01 |
| Gene synonyms/obsolete |
|
| Gene product |
ketopantoate
reductase; similar to Sp SPCC1902.02 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1686 |
| ORF length (spliced) |
|
| Entry clone length |
1686 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
431A:G / 519A:G /
1122T:C / 1417T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC24B11.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGACGCAGGAAAAAA |
| Rev primer name |
SPAC24B11.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGATTTCATGCGAGAAGTT |
| Amino acid length |
561 |
| Molecular weight |
62.4 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDTLLPLEI/LISSIQHLPL |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; cytoplasmic microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol;
periphery at cell tip) |
| Microscope used for
observation |
DeltaVision |