Gene name |
SPBC1A4.03c |
Gene ID |
34/B05 |
Gene synonyms/obsolete |
top2 |
Gene product |
DNA topoisomerase II;
DNA gyrase B domain |
Entry clone |
Cloned |
ORF length (unspliced) |
4514 |
ORF length (spliced) |
4458 |
Entry clone length |
4514 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
141A:G / 513A:G /
4503G:A |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC1A4.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCATTGATGCGGATTT |
Rev primer name |
SPBC1A4.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCACTCTCATCATAATCG |
Amino acid length |
1485 |
Molecular weight |
167.8 |
Isoelectric point (calc.) |
7.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
1225 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus as
dots>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |