Gene name |
SPBC4C3.05c |
Gene ID |
34/B06 |
Gene synonyms/obsolete |
nuc1; rpa1;
SPBC4C3.05a |
Gene product |
DNA-directed RNA
polymerase I (large subunit); involved in the formation of the
nucleolus (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
5070 |
ORF length (spliced) |
|
Entry clone length |
5070 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
475A:G / 857A:T /
2283T:C / 4749T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC4C3.05a.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATATTGCACAGCCAGT |
Rev primer name |
SPBC4C3.05a.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTTGCAGGAGAATCGACT |
Amino acid length |
1689 |
Molecular weight |
189.2 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LISLMPLTI |
Localization (YFP) |
cytosol; ambiguous
structure |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |