Gene name |
SPBC887.14c |
Gene ID |
33/H02 |
Gene synonyms/obsolete |
pif1; rph1 |
Gene product |
DNA helicase (5'-3');
involved in mitochondrial DNA repair (required); involved in
mitochondrial recombination; rrm3-pif1 helicase homolog;
essential; suppressor of the temperature-sensitive cdc24-M38;
single-stranded DNA-dependent ATPase; mutant cell cycle arrest
in late S/G2 at restictive temperature; mutant (pfh1-R20)
hyper sensitive to MMS; possibly required for the completion
of DNA replication1 |
Entry clone |
Cloned |
ORF length (unspliced) |
2459 |
ORF length (spliced) |
2418 |
Entry clone length |
2459 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
227A:G / 318T:C /
743A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC887.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTCGTGCCAATCTCT |
Rev primer name |
SPBC887.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTATTTTTGACTCCCCTC |
Amino acid length |
805 |
Molecular weight |
90 |
Isoelectric point (calc.) |
10.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LASVNGLPI |
Localization (YFP) |
nucleus;
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |