Gene name |
SPBC1703.14c |
Gene ID |
33/H03 |
Gene synonyms/obsolete |
top1 |
Gene product |
DNA topoisomerase
activity; non-essential; involved in establishment and/or
maintenance of chromatin architecture |
Entry clone |
Cloned# |
ORF length (unspliced) |
2544 |
ORF length (spliced) |
2445 |
Entry clone length |
2544 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC1703.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCGTCTGGTAAGGT |
Rev primer name |
SPBC1703.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCACTTCCAATCCGGAGGT |
Amino acid length |
814 |
Molecular weight |
93.9 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
14 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKMPKNLTL |
Localization (YFP) |
nucleolus>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |