Gene name |
SPBC26H8.07c |
Gene ID |
33/C09 |
Gene synonyms/obsolete |
nda3; ben1;
alp12 |
Gene product |
beta tubulin; involved
in control of microtubular organization; involved in
sensitivity to anti-mitotic benzimidazole compounds |
Entry clone |
Cloned |
ORF length (unspliced) |
1649 |
ORF length (spliced) |
1347 |
Entry clone length |
1649 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
1368G:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC26H8.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTGAGATTGTACGAGC |
Rev primer name |
SPBC26H8.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATACTCGAGAGGCTCCTTC |
Amino acid length |
448 |
Molecular weight |
49.4 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSIFANTLKI |
Localization (YFP) |
cytosol |
Comments for localization |
cytoplasmic dots and
aggregates by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |