Gene name |
SPBC1604.05 |
Gene ID |
33/C10 |
Gene synonyms/obsolete |
pgi1 |
Gene product |
glucose-6-phosphate
isomerase; involved in gluconeogenesis; involved in
glycolysis; involved in pentose-phosphate shunt;
glucose-6-phosphate isomerase activity |
Entry clone |
Cloned |
ORF length (unspliced) |
1653 |
ORF length (spliced) |
|
Entry clone length |
1653 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1604.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTTAGCTTAGCTTC |
Rev primer name |
SPBC1604.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATCCATTCTTGAAAAGG |
Amino acid length |
550 |
Molecular weight |
60.8 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; cytoplasmic
dots; Golgi? |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |