Gene name |
SPAC23G3.06 |
Gene ID |
33/C07 |
Gene synonyms/obsolete |
|
Gene product |
ribonucleoprotein
complex; processome component; involved in rRNA processing;
involved in ribosome biogenesis and assembly; snoRNA-binding
protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1636 |
ORF length (spliced) |
1527 |
Entry clone length |
1636 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
281A:G / 1293A:G /
1627A:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23G3.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTATTCTTACTGGTAT |
Rev primer name |
SPAC23G3.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCCTTTGACTTTTTGGAC |
Amino acid length |
508 |
Molecular weight |
55.7 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
496/453/484/472/17 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>>nucleus; nucleolar dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |