Gene name |
SPBC530.14c |
Gene ID |
33/C06 |
Gene synonyms/obsolete |
dsk1 |
Gene product |
serine/threonine
protein kinase; cell cycle stage dependent phosphorylation and
localization; mitotic regulator; involved in mRNA
splicing |
Entry clone |
Cloned |
ORF length (unspliced) |
1635 |
ORF length (spliced) |
|
Entry clone length |
1635 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
866C:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC530.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAGTGACGGGTCGAG |
Rev primer name |
SPBC530.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGAATTTCAGTAGCCCAT |
Amino acid length |
544 |
Molecular weight |
61 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol during
interphase; nucleus; SPB; periphery at site of septum
formation during mitosis |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |