| Gene name |
SPBP16F5.07 |
| Gene ID |
33/B01 |
| Gene synonyms/obsolete |
apm1 |
| Gene product |
adaptor complexes
medium subunit family; component of the adaptor complexes
which link clathrin to receptors in coated vesicles.
Clathrin-associated protein complexes are believed to interact
with the cytoplasmic tails of membrane proteins, leading to
their selection and concentration; belongs to the adaptor
complexes medium subunit family; contains 1 MHD (mu homology)
domain; interacts with sad1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1504 |
| ORF length (spliced) |
1281 |
| Entry clone length |
1504 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
31A:G / 300C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP16F5.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTCTGCTATATTCGT |
| Rev primer name |
SPBP16F5.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGACGGATGGAATATTCA |
| Amino acid length |
426 |
| Molecular weight |
48.9 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSGMPELRL |
| Localization (YFP) |
SPB; periphery at cell
tip and site of septum formation; nucleus>>cytosol |
| Comments for localization |
SPB at abnormal
spindle |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |