Gene name |
SPBC3H7.01 |
Gene ID |
33/A12 |
Gene synonyms/obsolete |
stl1; spo14;
SPBP16F5.01c |
Gene product |
WD repeat protein; 1
predicted transmembrane helix; required for the formation of
transport vesicles from the ER; This function involves the
cytoplasmic domain of the protein, which is thought to
interact with the small GTP-binding protein sar1; involved in
sporulation (required); involved in spore wall assembly
(required); essential |
Entry clone |
Cloned |
ORF length (unspliced) |
1493 |
ORF length (spliced) |
1188 |
Entry clone length |
1493 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
1152G:T /
1166A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3H7.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGAACTCCACCTTTC |
Rev primer name |
SPBC3H7.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGGTCATAGTTTCTAATC |
Amino acid length |
395 |
Molecular weight |
45 |
Isoelectric point (calc.) |
6.2 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSLMFPFVLAI |
Localization (YFP) |
ER; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |