Gene name |
SPAC4F10.11 |
Gene ID |
33/A11 |
Gene synonyms/obsolete |
spn1 |
Gene product |
septin; non-essential;
involved in cytokinesis; involved in septation; involved in
cell separation |
Entry clone |
Cloned |
ORF length (unspliced) |
1492 |
ORF length (spliced) |
1410 |
Entry clone length |
1492 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC4F10.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGTCAATGGTACTCGC |
Rev primer name |
SPAC4F10.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTAAAAAACTTCCTTTTA |
Amino acid length |
469 |
Molecular weight |
53.7 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus; a few
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |