Gene name |
SPAC17D4.01 |
Gene ID |
32/H11 |
Gene synonyms/obsolete |
pex7;
SPAC1834.12 |
Gene product |
peroxisomal targeting
signal receptor; WD repeat protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1383 |
ORF length (spliced) |
927 |
Entry clone length |
1383 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
575G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17D4.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGTCATTGAGGACTCC |
Rev primer name |
SPAC17D4.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATGCGTTCCATATATAC |
Amino acid length |
308 |
Molecular weight |
34.5 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |