Gene name |
SPBC1734.08 |
Gene ID |
32/H12 |
Gene synonyms/obsolete |
|
Gene product |
STAM like protein;
similar to mammalian signal transducing adaptor; VHS domain;
src (SH3) homology domain; possibly forms a complex with
Vps27p; involved in the recycling of Golgi proteins; putative
sorting receptor for ubiquitinated membrane proteins destined
for degradation |
Entry clone |
Cloned |
ORF length (unspliced) |
1397 |
ORF length (spliced) |
1122 |
Entry clone length |
1397 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1734.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTCGAGGAAAACCCAA |
Rev primer name |
SPBC1734.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAATTCCTCATCTCAGAC |
Amino acid length |
373 |
Molecular weight |
42.4 |
Isoelectric point (calc.) |
5.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi?; cytoplasmic
dots; nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |