Gene name |
SPBC16E9.17c |
Gene ID |
32/G07 |
Gene synonyms/obsolete |
rem1 |
Gene product |
B-type cyclin;
essential for meiotic progression; overexpression results in
cut phenotype |
Entry clone |
Cloned |
ORF length (unspliced) |
1294 |
ORF length (spliced) |
1209 |
Entry clone length |
1294 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
780A:G / 1028A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC16E9.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACTCTAACAACAAAAG |
Rev primer name |
SPBC16E9.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTACCATCCATCGCCATC |
Amino acid length |
402 |
Molecular weight |
46 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSHMEKLEI |
Localization (YFP) |
nucleus>cytosol;
nuclear envelope? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |