| Gene name |
SPBP4H10.09 |
| Gene ID |
32/G06 |
| Gene synonyms/obsolete |
rsv1 |
| Gene product |
transcription factor;
zinc finger protein; zf-C2H2 type; stationary phase viability
protein; required for cell viability in glucose starved
environment; similar to Sp src1 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1287 |
| ORF length (spliced) |
|
| Entry clone length |
1287 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP4H10.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAGTTACGAATGCCC |
| Rev primer name |
SPBP4H10.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATAAGATCTGGAAGGA |
| Amino acid length |
428 |
| Molecular weight |
46.8 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear dots;
spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |