| Gene name |
SPBC21D10.09c |
| Gene ID |
31/A12 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5022 |
| ORF length (spliced) |
4833 |
| Entry clone length |
5022 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
771G:A / 777G:A /
1148T:A / 2439A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC21D10.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAAAAAATCTACGGA |
| Rev primer name |
SPBC21D10.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAAATGTAAAGCTGCTG |
| Amino acid length |
1610 |
| Molecular weight |
184.3 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAVLFPRLSI/LTCVPMLRL/LSLTVQTVLYL/LTVLNELLI/LCPELLSLAI/LLNTLVEILNL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |