Gene name |
SPBC31E1.01c |
Gene ID |
31/A11 |
Gene synonyms/obsolete |
SPBC660.18c |
Gene product |
zinc finger protein;
zf-fungal Zn(2)-Cys(6) binuclear cluster domain; involved in
autophagy, sporulation, and protein-vacuolar targeting |
Entry clone |
#Not cloned yet |
ORF length (unspliced) |
5011 |
ORF length (spliced) |
4941 |
Entry clone length |
5011 |
No. of intron |
1 |
Sequence status |
#Not cloned yet |
Sequence results |
Not cloned yet |
Comments |
|
Polymerase used for cloning |
|
Fwd primer name |
SPBC31E1.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGTTACCCTCATGGCT |
Rev primer name |
SPBC31E1.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACCAGGCCGTTTGTATTTC |
Amino acid length |
1646 |
Molecular weight |
184.3 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |