Gene name |
SPAC23D3.13c |
Gene ID |
31/A10 |
Gene synonyms/obsolete |
|
Gene product |
conserved protein; Sc
deletion hypersensitive to brefeldin A or monensin, two drugs
that affect intracellular transport |
Entry clone |
Cloned |
ORF length (unspliced) |
5006 |
ORF length (spliced) |
4851 |
Entry clone length |
5006 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
3771A:G /
4229T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23D3.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTTATATGATAGTCT |
Rev primer name |
SPAC23D3.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATTGCGTTCAACACCTCA |
Amino acid length |
1616 |
Molecular weight |
181.4 |
Isoelectric point (calc.) |
5.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNSIQLLAI/LEEAFQLMLRL/LDVDFLSSLQL/LNAILGQLTL |
Localization (YFP) |
Golgi; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus; Golgi |
Microscope used for
observation |
Leica |