Gene name |
SPCC290.03c |
Gene ID |
31/A09 |
Gene synonyms/obsolete |
|
Gene product |
nucleoporin |
Entry clone |
Cloned |
ORF length (unspliced) |
4995 |
ORF length (spliced) |
4944 |
Entry clone length |
4995 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
105A:G / 374T:C /
831T:C / 2822T:C / 4456A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC290.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGTCTGGGAATCTCA |
Rev primer name |
SPCC290.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCTCTATAAAGATCCAAG |
Amino acid length |
1647 |
Molecular weight |
186.4 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSLTLSTQLNL/LAVLDGLNI/LCILRNVLSL/LEFMDILRI/LKPPVQRLMI/LLQIFILVL |
Localization (YFP) |
SPB?; nuclear dots;
nucleus>cytosol; nuclear envelope |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |