Gene name |
SPBC23E6.04c |
Gene ID |
31/A08 |
Gene synonyms/obsolete |
|
Gene product |
ubiquitin-protein
ligase (E3); associates with the 26S proteasome; HECT domain;
ankyrin or armadillo repeats |
Entry clone |
Cloned |
ORF length (unspliced) |
4950 |
ORF length (spliced) |
|
Entry clone length |
4950 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
2846A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC23E6.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTCTTCACTTCAGAA |
Rev primer name |
SPBC23E6.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGTAAGGTAATCTTGGAGG |
Amino acid length |
1649 |
Molecular weight |
186.4 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LECVQILRL/LLSSIAASLPL/LNLILTFLEL/LSNVRVLLL/LADIVNYSLSI/LLELIELAL |
Localization (YFP) |
large SPB |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |