| Gene name |
SPCC895.05 |
| Gene ID |
30/G10 |
| Gene synonyms/obsolete |
for3 |
| Gene product |
involved in cell
polarity, actin cable formation, microtubule cytoskeleton
organization and biogenesis; interacts physically with
SPAC23C4.08; actin-binding protein; similar to Sp cdc12 and
fus1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4386 |
| ORF length (spliced) |
|
| Entry clone length |
4386 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC895.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATCTAAAATGCCTGA |
| Rev primer name |
SPCC895.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGTTTTTGGCGGTCATTT |
| Amino acid length |
1461 |
| Molecular weight |
166.2 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSLLNVQLRI/LIDYLVATLAL/LDELKAELNL |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |