| Gene name |
SPAC3G6.01 |
| Gene ID |
30/G04 |
| Gene synonyms/obsolete |
hrp3 |
| Gene product |
helicase C-terminal
domain; DEAD/DEAH box helicase; chromodomain protein; involved
in heterochromatin silencing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4224 |
| ORF length (spliced) |
4167 |
| Entry clone length |
4224 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
511A:G / 1623A:G /
3144A:G / 3303T:C / 4215G:deletion / 4216A:deletion /
4217T:deletion |
| Comments |
1 aa deletion |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3G6.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTACAAGTGCTATAGC |
| Rev primer name |
SPAC3G6.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTCATCTTTTCATACATG |
| Amino acid length |
1388 |
| Molecular weight |
159.3 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDILGDYLSL/LVQRLNDLDI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |