Gene name |
SPAPJ736.01 |
Gene ID |
30/G03 |
Gene synonyms/obsolete |
rif1; tap1; tap11;
SPAC6F6.17 |
Gene product |
involved in telomere
maintenance; recruited to the telomeres by Taz1p |
Entry clone |
Cloned |
ORF length (unspliced) |
4203 |
ORF length (spliced) |
|
Entry clone length |
4203 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
13A:G / 1953T:C /
3658T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPJ736.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAAAAGAAATTGCTGT |
Rev primer name |
SPAPJ736.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAATTCTAGATAAAATA |
Amino acid length |
1400 |
Molecular weight |
155.8 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
1237 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |