| Gene name |
SPAPJ736.01 |
| Gene ID |
30/G03 |
| Gene synonyms/obsolete |
rif1; tap1; tap11;
SPAC6F6.17 |
| Gene product |
involved in telomere
maintenance; recruited to the telomeres by Taz1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4203 |
| ORF length (spliced) |
|
| Entry clone length |
4203 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
13A:G / 1953T:C /
3658T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPJ736.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAAAAGAAATTGCTGT |
| Rev primer name |
SPAPJ736.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAATTCTAGATAAAATA |
| Amino acid length |
1400 |
| Molecular weight |
155.8 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
1237 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |