| Gene name |
SPCC895.09c |
| Gene ID |
30/G02 |
| Gene synonyms/obsolete |
|
| Gene product |
RNA helicase; similar
to pre-mRNA splicing factors at the C terminus; UBA domain
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
4198 |
| ORF length (spliced) |
3984 |
| Entry clone length |
4198 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
1656T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC895.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTTCAAAAGGAAAAAA |
| Rev primer name |
SPCC895.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACACCGTTGCCTGCAATC |
| Amino acid length |
1327 |
| Molecular weight |
149.8 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
784 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEDALEWLII/LQNIGSLLNI/LLTLLKLVI/LGEYLVSLPI/LIDPLGKGLIL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (cytosol>nucleus,
partially) |
| Microscope used for
observation |
Leica |