| Gene name |
SPBC651.08c |
| Gene ID |
30/G05 |
| Gene synonyms/obsolete |
rpc1 |
| Gene product |
DNA-directed RNA
polymerase III |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4268 |
| ORF length (spliced) |
4218 |
| Entry clone length |
4268 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
107A:G / 130T:C /
429A:G / 1746A:G / 2751T:C / 2981T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC651.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGATCCTATTGATGA |
| Rev primer name |
SPBC651.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCCGTAATTTCCAATTGA |
| Amino acid length |
1405 |
| Molecular weight |
157.5 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNPLKVLNL |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
mitochondrion? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |