| Gene name |
SPAC4F10.16c |
| Gene ID |
30/F11 |
| Gene synonyms/obsolete |
|
| Gene product |
P-type ATPase; P4
type; aminophospholipid translocase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4150 |
| ORF length (spliced) |
4104 |
| Entry clone length |
4150 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
112T:C / 1248T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4F10.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTAGCCTAATCAATTT |
| Rev primer name |
SPAC4F10.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTATTAGAATCATCGAAT |
| Amino acid length |
1367 |
| Molecular weight |
154.2 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
9 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKSSLHGLSI/LSEQVSFLFL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |