| Gene name |
SPAC1687.09 |
| Gene ID |
30/F10 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein; predicted EF hand; serine-rich protein; no apparent
orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4140 |
| ORF length (spliced) |
|
| Entry clone length |
4140 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
29G:T / 3298T:C /
3675C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1687.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGCGATTCATCCCGT |
| Rev primer name |
SPAC1687.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCAGTCATCGCGCCCTCG |
| Amino acid length |
1379 |
| Molecular weight |
150 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
1352/1351/1345 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKNMESLSL |
| Localization (YFP) |
SPB; spindle
microtubules; periphery at cell tip and site of septum
formation; nuclear dots; nucleolus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |