| Gene name |
SPCC1183.05c |
| Gene ID |
30/E05 |
| Gene synonyms/obsolete |
lig4 |
| Gene product |
involved in DNA
repair; BRCT domain; involved in RAD52-independent repair of
DNA double-strand breaks |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3494 |
| ORF length (spliced) |
2772 |
| Entry clone length |
3494 |
| No. of intron |
9 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1183.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGAAGCCAAAGAGAC |
| Rev primer name |
SPCC1183.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGAATACAAAAACTACCT |
| Amino acid length |
923 |
| Molecular weight |
107.2 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNFLPYLTL/LLVELKQLDL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |