Gene name |
SPBC215.08c |
Gene ID |
30/E04 |
Gene synonyms/obsolete |
arg4 |
Gene product |
carbamoyl-phosphate
synthase; involved in arginine biosynthesis, glutamate
catabolism; ATP binding domain |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
3483 |
ORF length (spliced) |
|
Entry clone length |
3483 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
822A:C / 1319G:A /
1548T:C / 2723C:G / 3327T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC215.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATTGTGGGCTACGTC |
Rev primer name |
SPBC215.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGATCATGAGATCCGATC |
Amino acid length |
1160 |
Molecular weight |
127.4 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |