Gene name |
SPAC6F6.06c |
Gene ID |
30/E03 |
Gene synonyms/obsolete |
|
Gene product |
involved in cell
polarity |
Entry clone |
Cloned |
ORF length (unspliced) |
3468 |
ORF length (spliced) |
|
Entry clone length |
3468 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1544T:C / 1718A:G /
2036C:T / 3244T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6F6.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAATTTATTCCTCCTT |
Rev primer name |
SPAC6F6.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTGGGTCTTTAATTCTTTT |
Amino acid length |
1155 |
Molecular weight |
128.3 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
2 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |