Gene name |
SPCC736.14 |
Gene ID |
29/G02 |
Gene synonyms/obsolete |
dis1 |
Gene product |
microtubule-associated
protein; involved in sister chromatid separation (required);
phosphorylated at the Cdc2p target sites; basic central region
is essential for microtubule association; involved in spindle
kinetochore attachment; plus end-binding microtubule
destabilizer; MAP215/Dis1 family; HEAT repeat |
Entry clone |
Cloned |
ORF length (unspliced) |
2916 |
ORF length (spliced) |
2649 |
Entry clone length |
2916 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
197T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC736.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTTGGACGATTTTAA |
Rev primer name |
SPCC736.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACGCCTTCTTCATCCTTTGG |
Amino acid length |
882 |
Molecular weight |
97.5 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRWLNRCLQL/LFREINDLQI |
Localization (YFP) |
cytoplasmic
microtubules; spindle microtubules; SPB; cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle |
Microscope used for
observation |
DeltaVision |