| Gene name |
SPCC736.14 |
| Gene ID |
29/G02 |
| Gene synonyms/obsolete |
dis1 |
| Gene product |
microtubule-associated
protein; involved in sister chromatid separation (required);
phosphorylated at the Cdc2p target sites; basic central region
is essential for microtubule association; involved in spindle
kinetochore attachment; plus end-binding microtubule
destabilizer; MAP215/Dis1 family; HEAT repeat |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2916 |
| ORF length (spliced) |
2649 |
| Entry clone length |
2916 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
197T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC736.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTTGGACGATTTTAA |
| Rev primer name |
SPCC736.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGCCTTCTTCATCCTTTGG |
| Amino acid length |
882 |
| Molecular weight |
97.5 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRWLNRCLQL/LFREINDLQI |
| Localization (YFP) |
cytoplasmic
microtubules; spindle microtubules; SPB; cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle |
| Microscope used for
observation |
DeltaVision |