Gene name |
SPCP25A2.02c |
Gene ID |
29/G03 |
Gene synonyms/obsolete |
rhp26 |
Gene product |
involved in
nucleotide-excision repair; involved in DNA repair; involved
in meiotic recombination; SNF2 family; DEAD/DEAH box helicase;
helicase C-terminal domain; human Cockayne syndrome B
homolog |
Entry clone |
Cloned |
ORF length (unspliced) |
2922 |
ORF length (spliced) |
|
Entry clone length |
2922 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1901T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCP25A2.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGTCAATGAAGATCT |
Rev primer name |
SPCP25A2.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCGTCTCTGTTTTAGTCGG |
Amino acid length |
973 |
Molecular weight |
110.9 |
Isoelectric point (calc.) |
8.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKVIRALLTL |
Localization (YFP) |
nucleus>>cytosol; nuclear dots and cytoplasmic
dots by over expression |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
Microscope used for
observation |
Confocal |