| Gene name |
SPCP25A2.02c |
| Gene ID |
29/G03 |
| Gene synonyms/obsolete |
rhp26 |
| Gene product |
involved in
nucleotide-excision repair; involved in DNA repair; involved
in meiotic recombination; SNF2 family; DEAD/DEAH box helicase;
helicase C-terminal domain; human Cockayne syndrome B
homolog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2922 |
| ORF length (spliced) |
|
| Entry clone length |
2922 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1901T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCP25A2.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGTCAATGAAGATCT |
| Rev primer name |
SPCP25A2.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGTCTCTGTTTTAGTCGG |
| Amino acid length |
973 |
| Molecular weight |
110.9 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKVIRALLTL |
| Localization (YFP) |
nucleus>>cytosol; nuclear dots and cytoplasmic
dots by over expression |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
| Microscope used for
observation |
Confocal |