Gene name |
SPCC970.08 |
Gene ID |
29/G01 |
Gene synonyms/obsolete |
|
Gene product |
inositol polyphosphate
kinase |
Entry clone |
Cloned |
ORF length (unspliced) |
2904 |
ORF length (spliced) |
|
Entry clone length |
2904 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
318A:G / 1730A:G /
2085T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC970.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGAACGCACCAAAGTG |
Rev primer name |
SPCC970.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGTAGACGTCTCTCCGCAA |
Amino acid length |
967 |
Molecular weight |
108.7 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEDVPRLIL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
Microscope used for
observation |
Confocal |