| Gene name |
SPAC3A11.09 |
| Gene ID |
29/A05 |
| Gene synonyms/obsolete |
|
| Gene product |
sodium/hydrogen
exchanger family |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2495 |
| ORF length (spliced) |
2280 |
| Entry clone length |
2495 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
820A:G / 1855A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A11.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATGGAGTCAAGTCGA |
| Rev primer name |
SPAC3A11.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCCCAGGCACGGGTAAGT |
| Amino acid length |
759 |
| Molecular weight |
85.4 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
664 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFMLCSLII/LSFLESLAI/LGKRINTLAL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |