| Gene name |
SPCC553.02 |
| Gene ID |
29/A04 |
| Gene synonyms/obsolete |
|
| Gene product |
glutamine-dependent
NAD(+) synthetase; conserved eukaryotic protein; involved in
nicotinamide adenine dinucleotide biosynthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2494 |
| ORF length (spliced) |
2103 |
| Entry clone length |
2494 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
1210A:G / 1684G:A /
2109T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC553.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACGATATGTAACCAT |
| Rev primer name |
SPCC553.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTTCTTTGATGCTGTTCA |
| Amino acid length |
700 |
| Molecular weight |
79.5 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |