| Gene name |
SPCC31H12.07 |
| Gene ID |
28/G09 |
| Gene synonyms/obsolete |
sec231; sec23a;
SPCC5E4.01 |
| Gene product |
GTPase activator;
zinc-binding protein; involved in intracellular protein
transport; COPII-coated vesicle component; involved in ER to
Golgi transport; similar to Sp SPBC776.04 |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2453 |
| ORF length (spliced) |
2280 |
| Entry clone length |
2453 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC31H12.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTTCGAAGAAATCGA |
| Rev primer name |
SPCC31H12.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAAACAGCTACGGCAAGT |
| Amino acid length |
759 |
| Molecular weight |
84.8 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQALKDSLII |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |