| Gene name |
SPAC19G12.15c |
| Gene ID |
28/G10 |
| Gene synonyms/obsolete |
tpp1 |
| Gene product |
trehalose-6-phosphate
phosphatase; glycosyl transferase family 20;
trehalose-phosphatase; involved in trehalose metabolism;
involved in stress response (required); G1 arrest mutant;
phosphatidate phosphatase; similar to Sp SPAC3G6.09C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2454 |
| ORF length (spliced) |
|
| Entry clone length |
2454 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1087T:C /
2341T:C |
| Comments |
ApaI or SacII should
be used instead of NotI for integration using pDUAL. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19G12.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGTGTACGGAAAAAT |
| Rev primer name |
SPAC19G12.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTAGTAAAATTTGCCAAA |
| Amino acid length |
817 |
| Molecular weight |
93.8 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal |