| Gene name |
SPBC244.03 |
| Gene ID |
28/G08 |
| Gene synonyms/obsolete |
sec27;
SPBC16C6.13c |
| Gene product |
coatomer (beta'
subunit); 6 WD repeat protein; the coatomer is a cytosolic
protein complex that binds to dilysine motifs and reversibly
associates with Golgi non- clathrin-coated vesicles, which
further mediate biosynthetic protein transport from the ER,
via the Golgi up to the trans Golgi network; Coatomer complex
is required for budding from Golgi membranes, and is essential
for the retrograde Golgi-to-ER transport of dilysine-tagged
proteins (By similarity) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2453 |
| ORF length (spliced) |
2391 |
| Entry clone length |
2453 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1208T:C / 1828T:C /
2324T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC244.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGCGACTAGATTTTCA |
| Rev primer name |
SPBC244.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTTAAGTTCCAAGTCA |
| Amino acid length |
796 |
| Molecular weight |
89.8 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |