| Gene name |
SPBC530.08 |
| Gene ID |
28/G07 |
| Gene synonyms/obsolete |
|
| Gene product |
transcriptional
regulator; zinc finger protein; zf-fungal Zn(2)-Cys(6)
binuclear cluster domain; possibly binds Pst1 histone
deacytylase B by similarity to Sc SIN complex protein
(transcriptional regulator of RNA polymerase II); predicted
membrane-tethered transcription factor; NLS (bipartite) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2448 |
| ORF length (spliced) |
|
| Entry clone length |
2448 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC530.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAATGAATCTCATAG |
| Rev primer name |
SPBC530.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTATTTTGCGAGTCTTTC |
| Amino acid length |
815 |
| Molecular weight |
93.5 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
Predicted
(N-terminus); NLS (bipartite) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
23 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPGIEEALCI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |