Gene name |
SPCP1E11.01c |
Gene ID |
28/G06 |
Gene synonyms/obsolete |
SPCC1827.07c |
Gene product |
EXS family; involved
in signal transduction |
Entry clone |
Cloned |
ORF length (unspliced) |
2445 |
ORF length (spliced) |
2049 |
Entry clone length |
2445 |
No. of intron |
7 |
Sequence status |
Finished |
Sequence results |
1323G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCP1E11.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATTCGGAAAGTAAGG |
Rev primer name |
SPCP1E11.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGAAAACTGAGCTTCATCC |
Amino acid length |
682 |
Molecular weight |
80.5 |
Isoelectric point (calc.) |
9.4 |
Signal SEQ |
|
No. of transmembrane domain |
8 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLDFYDYLKL |
Localization (YFP) |
ER; Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |