| Gene name |
SPCC794.08 |
| Gene ID |
28/G05 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
2437 |
| ORF length (spliced) |
2397 |
| Entry clone length |
2437 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
188A:G / 286A:G /
1548T:C / 1686T:C / 2087A:G / 2183T:C / 2229T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC794.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGGTTACTATTTCGTTC |
| Rev primer name |
SPCC794.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTGCGTACATATGGAGGA |
| Amino acid length |
798 |
| Molecular weight |
90.3 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |