| Gene name |
SPAC19G12.14 |
| Gene ID |
28/E06 |
| Gene synonyms/obsolete |
its3 |
| Gene product |
1-phosphatidylinositol-4-phosphate 5-kinase
activity; involved in cytokinesis (regulation); coordinately
regulates cytokinesis with Ppb1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2378 |
| ORF length (spliced) |
2229 |
| Entry clone length |
2378 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
(-8)G:addition /
2323A:G |
| Comments |
ApaI or SacII should
be used instead of NotI for integration using pDUAL. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19G12.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAATTGATTCAAACGG |
| Rev primer name |
SPAC19G12.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGATGAAGAAGTGTTCGTA |
| Amino acid length |
742 |
| Molecular weight |
83.7 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal |