| Gene name |
SPAC13A11.01c |
| Gene ID |
28/E05 |
| Gene synonyms/obsolete |
SPAC2F7.18c |
| Gene product |
GTPase activator; Rho
specific; RhoGAP domain; DEP domain; FCH domain; predicted
coiled-coil region; phosphorylated by Shk1p; |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2378 |
| ORF length (spliced) |
2334 |
| Entry clone length |
2378 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
2054T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13A11.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATATCGAGCTTTTCAAA |
| Rev primer name |
SPAC13A11.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTACCACTTAAACTGGAA |
| Amino acid length |
777 |
| Molecular weight |
88.2 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLCTLCHLLVI |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |