| Gene name |
SPAC1834.11c |
| Gene ID |
28/E07 |
| Gene synonyms/obsolete |
sec18 |
| Gene product |
required for
vesicle-mediated transport; catalyzes the fusion of transport
vesicles within the Golgi cisternae; is also required for
transport from the endoplasmic reticlum to the Golgi stack;
seem to function as a fusion protein required for the delivery
of cargo proteins to all compartments of the Golgi stack
independent of vesicle origin (By similarity); the AAA ATPase
family |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2379 |
| ORF length (spliced) |
|
| Entry clone length |
2379 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
962C:T / 1552G:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1834.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACTCAAGATGGAAACT |
| Rev primer name |
SPAC1834.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCCATAGGAATAGCACGG |
| Amino acid length |
792 |
| Molecular weight |
87.5 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |