Gene name |
SPAC57A10.02 |
Gene ID |
28/D01 |
Gene synonyms/obsolete |
cdr2 |
Gene product |
serine/threonine
protein kinase; invovled in G2/M progression (regulation);
involved in cytokinesis (regulation); involved in mitotic
start (regulation); involved in cell separation; nim1
family |
Entry clone |
Cloned |
ORF length (unspliced) |
2328 |
ORF length (spliced) |
|
Entry clone length |
2328 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1562G:C / 1603C:T /
1605A:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC57A10.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTACAATTTCAGAAGT |
Rev primer name |
SPAC57A10.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTTTGGACGGATTGTCGT |
Amino acid length |
775 |
Molecular weight |
85.9 |
Isoelectric point (calc.) |
7.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery; nuclear
dots; SPB? |
Comments for localization |
SPB by over
expression? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |